Biochemistry I   Spring & Fall Terms

RNA Polymerase Holoenzyme-Promoter Complex

  Rotate:
  Y 90°   Y -90°
  X 90°   X -90°

  Distances:
  Height (Å)
  Width (Å)

  Background Color:
  White
  Blue
  Black

  Reset orientation.
  Remove labels.

Thermus aquaticus RNA Polymerase Holoenzyme-Promoter Complex at 4.0 Å Resolution.
The holoenzyme is composed of the catalytic core (subunits bb'a2w) and the specificity subunit (s). The molecular weight of the holoenzyme is 480 kDa.
The enzyme is shown bound to a fragment of DNA that contains most of the sequence-specific elements required for transcription initiation. However, the start-site for transcription is not included in this model.
(cf. Figs. 10.1-10.3 in Campbell).

The color coding used for the (labeled) subunits and DNA strands is:
Beta subunit: Blue
Beta-prime subunit : Green
Alpha subunits: Gray
Omega subunit : Gray
Sigma subunit: Red
Template DNA strand: Cyan
Nontemplate DNA strand: Yellow
The DNA sequences in the model are:
5'GGCCGCTTGACAAAAGTGTTAAATTGTGCTATACT 3'
3'CCGGCGAACTGTTTTCACAATTTAACACGA 5'
The -35 region and -10 region sequences are shown above in bold on the nontemplate strand; they are also labeled in the model. Note that the s-subunit contacts both of these regions in the complex.

Note: The coordinates used in this display have only the alpha carbons of the proteins (CA) and the DNA backbone atoms. Thus, Backbone and Spacefill are the only Chime display options available.

This structure is described in Murakami, K. S., Masuda, S., Campbell, E. A., Muzzin, O., Darst, S. A. (2002) "Structural Basis of Transcription Initiation: An RNA Polymerase Holoenzyme-DNA Complex "Science 2961285.     PubMed Abstract.

Back to the Protein Structure List.

smBack Return to Home Page Fall 2004 -or- Home Page Spring 2004.

8.21.04